The extraction process required to make dOMV removes lipoproteins, including fHbp, and increases the cost of production of dOMV relative to GMMA. The fHbp gene is present in most invasive meningococcal isolates independent of the serogroup. fHbp can be divided into three antigenic variants (v. 1, 2 or 3) [11] or into at least nine modular groups based on the combination of five variable α and β fHbp segments [12] and [13]. Individual peptides within each variant are identified check details by a unique peptide ID. The outer membrane protein, PorA, is highly immunogenic but antibodies tend to provide subtype-specific protection [14]. African meningococcal isolates are relatively conserved in

relation to fHbp variant and PorA subtype [15] and [16]. Invasive serogroup A and X strains predominantly express fHbp v.1. PorA subtype P1.5,2 is shared by most serogroup W strains and P1.20,9 is expressed by the majority of A strains [15]. FDA approved Drug Library cell line This epidemiological pattern makes a protein-based vaccine both a possible and attractive approach for sub-Saharan Africa. A vaccine

for the meningitis belt needs to be affordable and large-scale low-cost production of a GMMA vaccine has to be feasible. Deletions of gna33 or rmpM, that augment the release of these outer membrane particles can reduce costs [17], [18], [19], [20] and [21]. In this study, we selected a vaccine strain based on a panel of African W strain capsule and gna33 double knock-out mutants. from The isolate with the highest GMMA production was then further engineered for the deletion of lpxL1 and over-expression of

fHbp v.1 (ID1). This genetic approach may form the basis for a broadly-protective, safe and economic vaccine for sub-Saharan Africa. Three African serogroup W, seven A and seven X strains were the target strains for serum bactericidal assays. Nine African serogroup W strains were screened as potential vaccine production strains (Table 1). Carrier strain 1630 (ST-11) expressing PorA subvariant P1.5,2 and fHbp v.2 (ID23) was chosen for GMMA production [22]. To abolish capsule production, a fragment of the bacterial chromosome containing synX, ctrA and the promoter controlling their expression, was replaced with a spectinomycin-resistance gene. First, the recombination sites were amplified with primers ctrAf_Xma:CCCCCCGGGCAGGAAAGCGCTGCATAG and ctrAr_XbaCGTCTAGAGGTTCAACGGCAAATGTGC; Synf_KpnCGGGGTACCCGTGGAATGTTTCTGCTCAA and Synr_SpeGGACTAGTCCATTAGGCCTAAATGCCTG from genomic DNA from strain 1630. The fragments were inserted into plasmid pComPtac [23] upstream and downstream of the chloramphenicol resistance gene. Subsequently the chloramphenicol resistance gene was replaced with a spectinomycin resistance cassette. The lpxL1 gene was deleted by replacement with a kanamycin resistance gene [24], and the gna33 gene with an erythromycin resistance cassette [25]. fHbp expression was up-regulated using multicopy plasmid encoding fHbp v.1 (ID1) [26].