Beyond the antennal lobe we observed astrocyte-like glial spontaneous

calcium activities in the ventromedial protocerebrum, indicating that astrocyte-like glial spontaneous calcium elevations might be general in the adult fly brain. Overall, our study demonstrates a new function for astrocyte-like glial cells in the physiological modulation of olfactory information transmission, possibly through regulating ORN–PN synapse strength. “
“In many retinal diseases, it is the death of photoreceptors that leads to blindness. In previous in vitro and in vivo studies, basic fibroblast growth factor (bFGF) has been shown to increase retinal cell survival. More recently, reactive oxygen species (ROS) have also been shown to promote cell survival, contrary to the traditional view that they are solely destructive molecules. Due to this possible link, Vemurafenib chemical structure we hypothesised that bFGF could stimulate the production

of ROS, which in turn stimulates the protein kinase B (Akt) survival pathway. Flow cytometry was used to measure the fluorescence of oxidised dihydrorhodamine, a ROS indicator, in the murine 661W photoreceptor cell line under several different conditions. Expression of cyclooxygenase (Cox) enzymes was evaluated by immunohistochemistry, and the response of photoreceptor cells to exogenous bFGF in the explanted mouse retina was studied by confocal microscopy. Exogenous addition of bFGF to 661W cells resulted in an increase in ROS production that lasted for 24 h. When this ROS production was inhibited, Rolziracetam bFGF-induced phosphorylation of Akt was prevented. Through the use of inhibitors and SGI-1776 mw small interfering RNA in the cell line, the source of this production was shown to be Cox and to involve the activation of phospholipases A2 + C. This pathway may also occur in the mouse retina, as we showed that the retina expressed Cox1&2, and that photoreceptors in explanted retina respond to bFGF by increasing their ROS levels. These results demonstrate that exogenous bFGF can stimulate ROS production

through the activation of Cox, and activate the Akt pathway. “
“Amyloid beta (Aβ), a key component in the pathophysiology of Alzheimer’s disease, is thought to target excitatory synapses early in the disease. However, the mechanism by which Aβ weakens synapses is not well understood. Here we showed that the PDZ domain protein, protein interacting with C kinase 1 (PICK1), was required for Aβ to weaken synapses. In mice lacking PICK1, elevations of Aβ failed to depress synaptic transmission in cultured brain slices. In dissociated cultured neurons, Aβ failed to reduce surface α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor subunit 2, a subunit of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors that binds with PICK1 through a PDZ ligand–domain interaction.

monocytogenes would be anticipated to encounter periods of sustained nutrient

deprivation. The development of the GASP phenotype is marked by the ability of bacteria from an aged culture to outcompete bacteria from a younger culture during long-term VE-821 in vivo stationary phase growth (Finkel, 2006). GASP thus requires that a bacterial strain be capable of surviving for an extended period of time following its inoculation into growth medium. To measure the survival of L. monocytogenes during nutrient starvation, bacteria grown in nutrient-rich broth (BHI) were assessed for viability following incubation for 12 days at 37 °C. Cultures exhibited a characteristic lag, logarithmic, and stationary growth phase during the first 24 h of growth

(Fig. 2a). After remaining in stationary phase for 1–2 days, L. monocytogenes entered a death phase during which an approximate 90% loss of cell viability was observed over 24 h. The subsequent bacterial population then maintained a stable cell density representative of a long-term stationary growth phase that persisted for the remaining days (Fig. 2a). The ability of L. monocytogenes to express the GASP phenotype was next assessed. As E. coli cultures need to be at least 8 days old (when cultured in LB under aerobic conditions) to express the GASP phenotype (Zambrano et al., 1993; Finkel, 2006), we aged L. monocytogenes cultures for 12 days prior to the assessment for GASP as an arbitrary staring point. Bacteria from a L. monocytogenes 12-day-old culture were

added to a 1-day-old culture at a ratio of 1 : 100 (Fig. 1). Bacteria from the 12-day-old culture outcompeted bacteria TSA HDAC cost of the 1-day-old culture over 10 days, such that the ratio at day 10 was 10 : 1 of 12-day-old cells to 1-day-old cells (Fig. 2b). In contrast, when bacteria from a 1-day-old culture of L. monocytogenes were added to another 1-day-old culture at a ratio of 1 : 100, no change in this ratio was observed over 10 days (Fig. 2b). The competitive advantage exhibited by the bacteria from a 12-day-old culture was thus reflective of culture age, and indicated that L. monocytogenes is capable of expressing GASP. To determine if the PD184352 (CI-1040) L. monocytogenes GASP phenotype was the result of a stable genetic change, bacteria from a 12-day-old culture were grown in BHI to a high cell density, diluted 1 : 100 into fresh media, and once again grown to high cell density. This process was repeated every 24 h for a total of 12 cycles of dilution and outgrowth or passages (Fig. 1b). Bacteria from the passaged 12-day-old culture were then added to a 1-day-old culture of wild-type L. monocytogenes at a ratio of 1 : 100. Just as with bacteria from a non-passaged 12-day-old culture, bacteria from the passaged 12-day-old culture outcompeted bacteria of the 1-day-old culture over 10 days (Fig. 2b), thus indicating that L. monocytogenes GASP resulted from a stable genetic change.

Thus, the results of this study suggest that the production of immunogenic proteins during infection periods improves the diagnosis and discovery of vaccine candidates. “
“The aim of this research was to identify bacterial isolates having the potential to improve intestinal barrier function. Lactobacillus plantarum strains and human oral isolates were screened for their ability to enhance tight junction integrity as measured by the transepithelial electrical resistance (TEER) assay. Eight commercially used probiotics were compared to determine which

had the greatest positive effect on TEER, and the best-performing probiotic strain, Lactobacillus ABT 199 rhamnosus HN001, was used as a benchmark to evaluate the isolates. One isolate, L. plantarum DSM 2648, was selected for further study because it increased TEER 135% more than VX-809 cost L. rhamnosus HN001. The ability of L. plantarum DSM 2648 to tolerate gastrointestinal conditions and adhere to intestinal cells was determined, and L. plantarum DSM 2648 performed better than L. rhamnosus HN001 in all the assays. Lactobacillus plantarum DSM 2648 was able to reduce the negative effect of Escherichia coli [enteropathogenic E. coli (EPEC)] O127:H6 (E2348/69) on TEER and adherence by as much as 98.75%

and 80.18%, respectively, during simultaneous or prior coculture compared with EPEC incubation alone. As yet, the precise mechanism associated with the positive effects exerted by L. plantarum DSM 2648 are unknown, and may influence its use to improve human health and wellness. Probiotics are defined as ‘live microorganisms which, when administered in adequate amounts, confer a health benefit onto the host’ (Guarner & Schaafsma, 1998). Most probiotics

belong to the genera Lactobacillus and Bifidobacterium, and are often selected for their ability to grow in dairy products, survive gastrointestinal conditions and adhere to intestinal epithelial cells (Dunne et Cobimetinib concentration al., 2001; Delgado et al., 2008). Although these properties are important to the delivery of viable probiotics to the site of action, greater emphasis should be placed on selecting probiotics based on their specific health benefits to target particular consumer groups or health ailments (Gueimonde & Salminen, 2006). Probiotics can have a number of different mechanisms by which they are proposed to improve health, such as inhibition of pathogenic bacteria, improving epithelial and mucosal barrier function and altering the host’s immune response. Despite the known association between impaired intestinal barrier function, gastrointestinal disorders (Barbara, 2006; Bruewer et al., 2006; Guttman et al., 2006) and illnesses in other parts of the body (Liu et al., 2005; Maes, 2008; Maes & Leunis, 2008; Sandek et al., 2008; Vaarala et al., 2008), few studies have focused on selecting probiotics based on their ability to enhance intestinal barrier function.

An insertion mutant in this gene (atuR) expressed atu genes constitutively and the GCase protein was detected in cell extracts independent of the nature of the growth substrate (Fig. 1b). We conclude that atuR encodes a repressor of atu gene cluster expression and that inactivation Nutlin-3a nmr of atuR therefore results in a low, but constitutive expression of Atu proteins. If this assumption is true, AtuR should be able to specifically bind to the atuR-atuA intergenic sequence. The atuR gene was PCR amplified and cloned into

pET28a. The resulting construct, pSK3510, coded for an N-terminal his-tagged AtuR protein and was transformed into E. coli Rosetta 2 (DE3) pLysS RARE. Approximately 0.3 mg AtuR protein was purified from 800 mL

of an E. coli (pSK3510) LB culture (Fig. S2a). The quaternary structure of purified AtuR was analysed by analytical gel filtration on Superdex75. A value of 54±4 kDa was determined and suggested http://www.selleckchem.com/products/ganetespib-sta-9090.html that AtuR was present as a homodimer (26.9 kDa for monomer; Fig. S2b). The atuR-atuA intergenic region (280 bp) contains two perfect 13 bp inverted repeat sequences that are separated by a spacer sequence of 40 bp and are located immediately upstream of the ‘−10’ region of the atu gene cluster (Fig. 2). We speculated that this region could be important for atu gene cluster expression by acting as a potential binding site for AtuR protein. A 523-bp DNA fragment (DNA fragment #1) comprising the 5′-end of atuR

and the complete atuR-atuA intergenic region was PCR amplified and used as a binding substrate in EMSA. Figure 3a shows the EMSA results with different ratios of the atuR-atuA intergenic region and AtuR. The atuR-atuA intergenic region (DNA fragment #1) migrated with the expected size of ≈520 bp in a 6% polyacrylamide gel in the absence of AtuR (Fig. 3a, lane 6). A strong and complete shift of DNA fragment #1 towards higher apparent molecular masses (at the position of an ≈1000-bp DNA fragment) was observed when an eightfold or higher (10-fold) molar excess very of AtuR relative to the concentration of the atuR-atuA intergenic region was used (lanes 4 and 5 of Fig. 3a). Interestingly, lower amounts of AtuR (equal molar amount to twofold excess of AtuR relative to DNA fragment #1) resulted in the appearance of an intermediate shift (at an apparent position of ≈840 bp; Fig. 3a, lanes 1 and 2) in addition to the remaining unshifted DNA. This result indicates that the atuR-atuA intergenic region can bind different amounts of AtuR protein, resulting in different shift species. When a fourfold molar excess of AtuR was used, both shifted bands were obtained (at apparent 840 and 1000 bp. Fig. 3a, lane 3). Heat-inactivated AtuR (10 min, 95 °C) did not show any DNA-binding ability.

The aim of this study was to explore the current management of diabetes in Malta and to try to identify factors which may help improve diabetes management. Thus, this study specifically addressed the question of how diabetes was managed in Malta. The methodological approach involved reflexive http://www.selleckchem.com/products/obeticholic-acid.html ethnography. Carspecken’s16 five-stage method was used to collect and analyse observational and interview

data. In addition to the interviews, field notes were also made which detailed the environment in which the interview occurred and the JQ1 mw interviewees’ reactions to the questions. A reflective journal was also kept to help the researcher to identify her own prejudices and so enable a development of an understanding of the current health care provision. Five key stakeholders were invited to participate in the study. Ethical approval was sought and obtained from the University

of Malta Research Ethics Board. Oral informed consent was also obtained from individual interviewees. Purposive sampling was used in this study. This helped to ensure

that people with a range of experiences in Malta’s national health diabetes service were included in the sample. Five individuals were interviewed in this study: a senior government advisor, two senior diabetes consultants, a diabetes nurse and a diabetic Dipeptidyl peptidase service user. Data were collected by way of participant observation and five in-depth unstructured interviews. The interviews were conducted in the English language. All interviews were audio-taped and later transcribed. The primary approach to analysing the interviews was to listen to the tapes and write a verbatim account from the tape recordings of everything that was said during the interviews to ensure that the content was an accurate reflection of the interview. Following transcription, the data were coded and assigned to different sub-categories and categories. Three key themes emerged from the data: organisational factors, health care professional factors and patient factors. Tables 1–3 summarise categories and themes that emerged from the analysis of interviews conducted.

Embryonic dopamine neuron transplantation has provided symptomatic benefit for some individuals with Parkinson’s disease (PD). However, the efficacy of grafting is variable and less than would be predicted from the degree of dopamine replacement provided in many individuals (Freed et al., 2001; Olanow et al., 2003). While results from recent grafting trials for PD are disappointing, the rationale of replacing Selleck Pexidartinib cells lost in PD remains sound and interest in this approach is regaining popularity. Thus, the question remains why this potentially viable therapeutic approach has not yet fully succeeded.

One factor thought to underlie this lack of success is pathology within the parkinsonian striatum, the region of graft placement. It has been shown in patients with PD and animal models of the disease that dopamine depletion is associated with a host of plastic changes in the striatum (Brown & Gerfen, 2006; Deutch, 2006; Collier et al., 2007; Meurers et al., 2009). One such change involves the primary synaptic target of afferent nigral dopaminergic neurons and descending cortical glutamate neurons, the medium spiny neuron (MSN). Normal MSNs have an abundance of dendritic spines, critical sites for synaptic integration of striatal dopamine and glutamate. In advanced PD there is a marked atrophy of dendrites and spines on these

neurons Erastin solubility dmso (McNeill et al., 1988; Stephens et al., 2005; Zaja-Milatovic et al., 2005). Similar pathology is observed in mice and rats with severe dopamine depletion (Day et al., 2006; Neely et al., 2007). While the impact of this altered morphology on dopamine cell replacement is unclear, it would be anticipated Carbohydrate that an absence of these critical input sites would make it difficult for grafted dopamine neurons to re-establish normal connections needed for therapeutic

benefit. It is also possible that the structural abnormalities of MSNs in the dopamine-depleted striatum could result in inappropriate graft–host contacts leading to abnormal behaviors (e.g. graft-induced dyskinesias; GIDs). While little is known about the etiology of GIDs, we recently reported (Soderstrom et al., 2008) that in a rat model of PD aberrant synaptic features following dopamine cell grafting are associated with the expression of graft-mediated motor dysfunction. These data support the idea that abnormal synaptic reorganization within the grafted striatum contributes to the evolution of aberrant motor behaviors; however, the biological contributor(s) to aberrant graft–host connectivity remains uncertain. The current study was designed to test the hypothesis that preventing MSN dendritic spine loss would allow for more appropriate integration of grafted neurons into the host striatum, thus resulting in increased behavioral efficacy and preventing the development of abnormal motor behaviors.

Embryonic dopamine neuron transplantation has provided symptomatic benefit for some individuals with Parkinson’s disease (PD). However, the efficacy of grafting is variable and less than would be predicted from the degree of dopamine replacement provided in many individuals (Freed et al., 2001; Olanow et al., 2003). While results from recent grafting trials for PD are disappointing, the rationale of replacing Bortezomib cells lost in PD remains sound and interest in this approach is regaining popularity. Thus, the question remains why this potentially viable therapeutic approach has not yet fully succeeded.

One factor thought to underlie this lack of success is pathology within the parkinsonian striatum, the region of graft placement. It has been shown in patients with PD and animal models of the disease that dopamine depletion is associated with a host of plastic changes in the striatum (Brown & Gerfen, 2006; Deutch, 2006; Collier et al., 2007; Meurers et al., 2009). One such change involves the primary synaptic target of afferent nigral dopaminergic neurons and descending cortical glutamate neurons, the medium spiny neuron (MSN). Normal MSNs have an abundance of dendritic spines, critical sites for synaptic integration of striatal dopamine and glutamate. In advanced PD there is a marked atrophy of dendrites and spines on these

neurons Gefitinib (McNeill et al., 1988; Stephens et al., 2005; Zaja-Milatovic et al., 2005). Similar pathology is observed in mice and rats with severe dopamine depletion (Day et al., 2006; Neely et al., 2007). While the impact of this altered morphology on dopamine cell replacement is unclear, it would be anticipated GPX6 that an absence of these critical input sites would make it difficult for grafted dopamine neurons to re-establish normal connections needed for therapeutic

benefit. It is also possible that the structural abnormalities of MSNs in the dopamine-depleted striatum could result in inappropriate graft–host contacts leading to abnormal behaviors (e.g. graft-induced dyskinesias; GIDs). While little is known about the etiology of GIDs, we recently reported (Soderstrom et al., 2008) that in a rat model of PD aberrant synaptic features following dopamine cell grafting are associated with the expression of graft-mediated motor dysfunction. These data support the idea that abnormal synaptic reorganization within the grafted striatum contributes to the evolution of aberrant motor behaviors; however, the biological contributor(s) to aberrant graft–host connectivity remains uncertain. The current study was designed to test the hypothesis that preventing MSN dendritic spine loss would allow for more appropriate integration of grafted neurons into the host striatum, thus resulting in increased behavioral efficacy and preventing the development of abnormal motor behaviors.

PCR genotyping of mouse tail DNA was performed with the following primers: γ-2-forward, 5′- GGTGCTAGAGTCCTGATCCTA -3′; γ-2-reverse, 5′- AGTGGGTTGCATGGAGTCTC -3′, γ-7-forward, 5′-ACAGGAATCCTTATTCCCAG -3′; γ-7-reverse, 5′-CTGAGCTCATGACTTCATCC -3′. To evaluate the ataxic gait, footprints

of the mice were recorded. Ink was applied to the hind paws of the JAK inhibitor mice, which were allowed to walk on white paper along a narrow path. In Western blot analysis, we used the following primary antibodies (host species): TARP γ-2 (rabbit; see below), TARP γ-7 (rabbit; see below), GluA1 (rabbit; Watanabe et al., 1998), GluA2 (mouse; MAB397, Millipore), GluA3 (mouse; MAB5416, Millipore), GluA4 (guinea pig; Nagy et al., 2004), synaptophysin (mouse; MAB5258, Chemicon), PSD-95 (rabbit; Fukaya & Watanabe, 2000) and actin (mouse; MAB1501R, Chemicon). For immunohistochemistry we used GluA4 (guinea pig; Nagy et al., 2004) and glutamate–aspartate transporter (GLAST) antibodies (rabbit and guinea pig; Shibata et al., 1997), and also produced γ-2, γ-7, GluA1, GluA2 and GluA3 antibodies as described below. Affinity-purified antibodies to γ-2 and γ-7 were raised in the rabbit

and guinea pig using synthetic peptide CIQKDSKDSLHANTANR (302-318 amino acid residues, Genbank accession number AF077739) and CPAIKYPDHLHISTSP (260–274, AF361349), respectively, which were conjugated to keyhole limpet hemocyanin. We also immunized Alpelisib supplier rabbits, guinea pigs and goat to produce polyclonal antibodies to the C-termini of AMPA receptor GluA1–A3 subunits. Due to partial homology in the C-terminal sequences between GluA1 and GluA4 and between GluA2 and GluA3 (Fig. S1A), we selected the following sequences: amino acid residues Fludarabine mw 880–907 and 841–907 of GluA1 (GenBank, X57497) were used for antigen, affinity purification or for dot blot assay, respectively, and 853–883 of GluA3 (AB022342) were used

for antigen, affinity purification and dot blot assay, while residues 847–863 and 847–877 of GluA2 (X57498) were for antigen and affinity purification or for dot blot assay, respectively (Fig. S1A). Procedures for bacterial protein expression, immunization and purification of antibodies have been described previously (Fukaya et al., 2006). The specificity of the AMPA receptor subunit antibodies as well as no crossreactivity with other subunits was tested by immunoblot with brain extracts (Fig. S1B) and dot blot assay for C-terminal fragments (Fig. S1C), respectively. As a result, subunit-specific antibodies were obtained for GluA1 and GluA2 in the rabbit and guinea pig, and for GluA3 in the rabbit, guinea pig and goat. Preparation of fractionated protein samples and Western blotting was performed as previously described (Abe et al., 2004; Fukaya et al., 2006). Briefly, adult (8–16 weeks of age) animals were decapitated by cervical dislocation, and their cerebella were homogenized in homogenate buffer (0.32 m sucrose, 5 mm EDTA, 1 μm pepstatin, 2 μm leupeptin and 0.

Gels were stained using Coomassie® G-250 Stain (SimplyBlue™ SafeStain, Invitrogen) for detection of proteins. For detection of heme-containing proteins, 3,3′,5,5′-tetramethylbenzidine was used for staining, as described previously

(Thomas et al., 1976). The appropriate fractions from gel filtration were pooled and concentrated by Amicon Ultra-15 Centrifugal Filter Units (Millipore) to ∼400 μL. The concentration of cytochrome c and content of heme was determined by pyridine hemochrome analysis (Berry & Trumpower, 1987). UV-VIS spectra were recorded on Shimadzu UV1601PC spectrophotometer. learn more The molecular weight was determined by direct electrospray MS with an LTQ-Orbitrap Velos instrument. The purified protein was desalted, dried and dissolved in 0.1% formic acid in 50 : 50 water : acetonitrile. The MS analysis was performed by Proteomics Core Facility at University of Gothenburg, Sweden. Chlorate reductase was purified as described earlier (Thorell et al., 2003) with the modification that

cells were disrupted using a Bead beater (Biospec products) and that the polyethylene imine precipitation step was omitted. Protein concentration of chlorate reductase was determined by Pierce ®BCA Protein Assay Kit (Thermo Scientific). For kinetic studies, the purified cytochrome c-Id1 was reduced using a slight excess sodium dithionite. A stock solution containing nominally 6 mg dithionite mL−1, 17 mM NaOH and 4 μg mL−1 catalase was prepared using nitrogen-flushed water, and was standardized against horse heart cytochrome c. The reduction of cytochrome c-Id1 Dasatinib mw was monitored spectrophotometrically (Shimadzu UV1601PC; ultra-micro cuvette, Hellma, Sigma-Aldrich Sweden AB, Stockholm). The reaction medium was bis-tris-propane (25 mM, pH 7.2) and the final concentration of cytochrome was varied between 4 and 0.6 μM. Samples were mixed with catalytic amount of chlorate reductase (final concentration Janus kinase (JAK) about 0.14 μM) and dithionite (final concentration 28 μM).

Reactions were initiated by addition of chlorate (final concentration 85 mM) and followed by repeated recordings of spectra at 580–530 nm at 1-min intervals. Purification of the cytochrome c from periplasm using hydrophobic interaction chromatography followed by gel filtration, as described above, resulted in the preparation analyzed in Fig. 1. Fractions from gel filtration were analyzed by SDS-PAGE and stained for protein (Fig. 1a) or heme (Fig. 1b). The fractions denoted by arrows were judged sufficiently pure for further characterization. According to the gel electrophoresis, an apparent molecular weight of 6 kDa was estimated. However, MS analysis results in a value of 9434.7 Da. Analysis of tryptic peptides from in-gel digestion confirms that the purified cytochrome is the target protein described and denoted as the 6-kDa cytochrome c in the previous paper (Bäcklund et al., 2009).

Gels were stained using Coomassie® G-250 Stain (SimplyBlue™ SafeStain, Invitrogen) for detection of proteins. For detection of heme-containing proteins, 3,3′,5,5′-tetramethylbenzidine was used for staining, as described previously

(Thomas et al., 1976). The appropriate fractions from gel filtration were pooled and concentrated by Amicon Ultra-15 Centrifugal Filter Units (Millipore) to ∼400 μL. The concentration of cytochrome c and content of heme was determined by pyridine hemochrome analysis (Berry & Trumpower, 1987). UV-VIS spectra were recorded on Shimadzu UV1601PC spectrophotometer. click here The molecular weight was determined by direct electrospray MS with an LTQ-Orbitrap Velos instrument. The purified protein was desalted, dried and dissolved in 0.1% formic acid in 50 : 50 water : acetonitrile. The MS analysis was performed by Proteomics Core Facility at University of Gothenburg, Sweden. Chlorate reductase was purified as described earlier (Thorell et al., 2003) with the modification that

cells were disrupted using a Bead beater (Biospec products) and that the polyethylene imine precipitation step was omitted. Protein concentration of chlorate reductase was determined by Pierce ®BCA Protein Assay Kit (Thermo Scientific). For kinetic studies, the purified cytochrome c-Id1 was reduced using a slight excess sodium dithionite. A stock solution containing nominally 6 mg dithionite mL−1, 17 mM NaOH and 4 μg mL−1 catalase was prepared using nitrogen-flushed water, and was standardized against horse heart cytochrome c. The reduction of cytochrome c-Id1 see more was monitored spectrophotometrically (Shimadzu UV1601PC; ultra-micro cuvette, Hellma, Sigma-Aldrich Sweden AB, Stockholm). The reaction medium was bis-tris-propane (25 mM, pH 7.2) and the final concentration of cytochrome was varied between 4 and 0.6 μM. Samples were mixed with catalytic amount of chlorate reductase (final concentration Silibinin about 0.14 μM) and dithionite (final concentration 28 μM).

Reactions were initiated by addition of chlorate (final concentration 85 mM) and followed by repeated recordings of spectra at 580–530 nm at 1-min intervals. Purification of the cytochrome c from periplasm using hydrophobic interaction chromatography followed by gel filtration, as described above, resulted in the preparation analyzed in Fig. 1. Fractions from gel filtration were analyzed by SDS-PAGE and stained for protein (Fig. 1a) or heme (Fig. 1b). The fractions denoted by arrows were judged sufficiently pure for further characterization. According to the gel electrophoresis, an apparent molecular weight of 6 kDa was estimated. However, MS analysis results in a value of 9434.7 Da. Analysis of tryptic peptides from in-gel digestion confirms that the purified cytochrome is the target protein described and denoted as the 6-kDa cytochrome c in the previous paper (Bäcklund et al., 2009).