Total bacteria and selected species were quantified by targeting the rrs gene (Table 2). The reaction mix contained 0.75 × SYBR Premix Ex Taq (Lonza Verviers SPRL, Verviers, Belgium), 0.5 μM of each forward and reverse primer and 80 ng of DNA

template. Each reaction was run in triplicate in a final volume of 20 μL in 96-well reaction plates (Applied Biosystems, Courtaboeuf, France). Amplification programs consisted of one cycle at 95°C (10 s) and 40 denaturing cycles at 95°C (15 s) and SHP099 mw annealing Ro-3306 at 60°C (30 s) for total bacteria, Prevotella genus, Ruminococcus albus, Fibrobacter succinogenes and Ruminococcus flavefaciens. For Streptococcus bovis the annealing temperature was 63.9°C (30 s), while the amplification of Lactobacillus consisted

of one cycle at 95°C (10 min) and 40 denaturing cycles at 95°C (30 s) and annealing at 60°C (1 min). Absolute quantification was carried out for all bacteria using specific 16 S rDNA standards from R. flavefaciens c94 (ATCC 19208), R. albus 7(ATCC 27210), F. succinogenes S85 (ATCC 19169), S. bovis (DSM 20480), P. bryantii B14 (DSM 11371), and Lb. acidophilus. The results for counting of each species are expressed as % of total bacteria/g DM of rumen content. Only assays that fell in the range 90–110% of efficiency and with r 2 ≥ 0.98 were considered for further analysis. Table 2  rrs  gene based primers used for qPCR quantification and PCR-DGGE Target organism Primer set Primer sequences 5′ – 3′ Assay Reference Total bacteria 520 F AGCAGCCGCGGTAAT qPCR [14]   799 R2 CAGGGTATCTAATCCTGTT     Fibrobacter FibSuc3F GCGGGTAGCAAACAGGAT see more TAGA qPCR [15] succinogenes FibSuc3R CCCCCGGACACCCAGTAT     Ruminococcus RumAlb3F TGTTAACAGAGGGAAGCAAAGCA qPCR [15] albus RumAlb3R TGCAGCCTACAATCCGAACTAA     Ruminococcus RumFla3F TGGCGGACGGGTGAGTAA qPCR [15] flavefaciens RumFla3R TTACCATCCGTTTCCAGAAGC T     Genus PrevGen4F GGTTCTGAGAGGAAGGTCCCC qPCR [15] Prevotella PrevGen4R TCCTGCACGCTACTTGGCTG     Streptococcus StrBov2F TTCCTAGAGATAGGAAGTTTCTTC GG qPCR [15] bovis StrBov2R ATG ATG GCA ACT AAC AAT AGG GGT     Genus Lacto 05 F AGC

AGT AGG GAA TCT TCC A qPCR [16] Lactobacillus Lacto 04R CGCCACTGGTGTTCYTCCATATA     Total bacteria GC + Eub340F CGCCCGCCGCGCGCGGCGGGCGGGGCG GGGGCACGGGGGGTCCTACGGGAGGCAGCAG Tangeritin DGGE [17–19]   HDA2R GTA TTA CCG CGG CTG CTG GCA C     PCR and Denaturing Gradient Gel Electrophoresis (DGGE) The V3 region of the bacterial rrs gene was amplified in PCR using primers Eub340F [17, 18] and HDA2R [19]. The Eub340F primer was modified for broader bacterial coverage and was tested in association with HDA2R on pure culture microorganisms. In all cases, the primer pair produced single PCR products that matched the target sequence from known microorganisms (E. Galbraith, unpublished data). For DGGE, a 40 bp GC clamp was added to the 5’ end of the forward primer Eub340F (Table 2). In 50 μL final volume, each reaction contained 2.