Triparental conjugations with Escherichia coli

CC118λpir(pEVS104) [57] were performed CYC202 to introduce pABGA11 and pABGA13 into V. parahaemolyticus RIMD2210633 and selection of first recombinants was performed on LBN agar containing 5 μg/ml chloramphenicol. Subsequently find more second recombinants were selected on LBN agar containing 10% sucrose and then screened by PCR with primers PrAB49 and PrAB50 for vscN1 and primers PrAB45 and PrAB59 for vscN2. Bacteria that contained the gene of the expected shortened length were designated VVN1 for the vscn1 mutant strain and VVN2 for the vscn2 mutant strain. V. parahaemolyticus VVE1 containing a mutated vp1680 gene was constructed in a similar manner utilising primers PrAB88 (AAACATGGCACTGTAAGCGTCG), PrAB89 (GGTTAGCGCACTCAAGCAAATGCTTGGC),

PrAB91 (GCGCGTAAGAGGCTTAGAGC) and PrAB92 (GCTTGAGTGCGCTAACCTAAGCAAACTTG) to remove nucleotides 161-1120. In addition a TAA stop codon was introduced at codon 51 (altered nucleotide click here shown in italics) so that a truncated protein would be produced. V. parahaemolyticus and epithelial cell line co-incubation studies All experiments with Caco-2 cells were carried out on differentiated cells obtained by culturing of the cells for 7 days (3 days post-confluency). HeLa cells were seeded the day prior to the co-incubation. During co-incubations with bacteria the cells were maintained in growth medium free of Pen-Strep antibiotics. Bacteria were cultured to obtain cells in mid-log phase of growth and then washed with PBS. Monolayers were co-incubated with WT V. parahaemolyticus and constructed deletion mutants at an MOI of 10. After the co-incubation period samples were taken for analysis. Preliminary experiments were performed with a range of MOI. Cells infected with an MOI of 10 displayed reproducible and reliable MAPK activation and cell lysis data and so this MOI was selected for use throughout these studies. In some experiments MAPK inhibitors were added to

the cells 2 h prior to the addition of the bacteria at these concentrations: 15 μM SP600125, 5 μM SB203580 and 40 μM PD184352. Lactate Dehydrogenase (LDH) assay The Caco-2 cells were co-incubated with bacteria for Cobimetinib mouse 1, 2, 3 or 4 h. The LDH assay was performed using the CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega) according to the manufacturer’s instructions. The results obtained were analyzed using the formulas provided by manufacturer and expressed as percentage cell lysis. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay The Caco-2 cells were co-incubated with bacteria for 1, 2, 3 or 4 h. The cells were washed and resuspended first in fresh complete medium containing 50 μg/ml gentamicin for 1 h and then 5 μg/ml gentamicin for 20 h to kill extracellular bacteria. Monolayers were then incubated in MTT solution (5 mg/ml; 50 μl/well) for a further 3 h.